anti cav 1  (Cell Signaling Technology Inc)

Journal: ACS Nano

Article Title: Caveolar Endocytosis Governs Nanoneedle Transfection

doi: 10.1021/acsnano.5c11011

Figure Lengend Snippet: Caveolae-mediated endocytosis is inactive in Tregs. (a–c) Delivery efficiency on Flat RCF and nN RCF for the pathway-specific cargoes (a) transferrin (Tfn), (b) Dextran 3000, and (c) Dextran 10k. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bars. (d–f) Representative flow cytometry histograms for the data presented in (a–c). (g) Delivery efficiency on Flat RCF and nN RCF for the caveolae-specific cargo cholera toxin B (CTxB). Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bars. (h) Representative flow cytometry histograms for the data in (g). (i) Western blot of Caveolin-1 (CAV-1) expression in MG63 +ve and Treg −ve, with β-actin as loading control.

Article Snippet: The CAV-1 sgRNA target sequence (AUGUUGCCCUGUUCCCGGAU) was ordered from Synthego.

Techniques: Flow Cytometry, Western Blot, Expressing, Control

Journal: ACS Nano

Article Title: Caveolar Endocytosis Governs Nanoneedle Transfection

doi: 10.1021/acsnano.5c11011

Figure Lengend Snippet: Caveolin 1 knockout abolishes nanoneedle transfection in MG63 cells. (a) Western blot of CAV-1 expression in MG63 knockout cell clones (MG63 −ve C1, C2, and C3) and MG63 (MG63 +ve). (b–d) Representative confocal fluorescence image of CAV-1 expression and localization in (b) MG63 +ve, (c) MG63 −ve, and (d) Treg −ve cells after 6 h incubation. Scale bar: 2 μm. (e) CAV-1 expression levels in MG63 +ve, MG63 −ve, and Tregs. One-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (f) Representative flow cytometry histograms of CTxB uptake in MG63 +ve and MG63 −ve for Flat and nN. (g) Cholera toxin B (CTxB) delivery efficiency in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (h) Representative flow cytometry histograms of transferrin (Tfn) uptake in MG63 +ve and MG63 −ve for Flat and nN. (i) Tfn delivery efficiency in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (j) Representative flow cytometry contour plots of the delivery ( Y -axis, Cy5 fluorescence) and transfection ( X -axis, eGFP fluorescence) of Cy5-eGFP in MG63 +ve and MG63 −ve for Flat and nN. (k) Delivery efficiency (Cy5 + cell population: Q1 + Q2) in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (l) MFI values of Cy5 for groups presented in (k). Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (m) Transfection efficiency (Cy5 + eGFP + cell population: Q2) in MG63 +ve and MG63 −ve for Flat and nN. Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA, followed by Tukey’s multiple comparisons test. p -values are indicated above the bars. (n) MFI values of eGFP fluorescence for groups presented in (m). Data presented as mean ± SD, n = 3 independent samples, two-way ANOVA, followed by Tukey’s multiple comparisons test. p -values are indicated above the bars.

Article Snippet: The CAV-1 sgRNA target sequence (AUGUUGCCCUGUUCCCGGAU) was ordered from Synthego.

Techniques: Knock-Out, Transfection, Western Blot, Expressing, Clone Assay, Fluorescence, Incubation, Flow Cytometry

Journal: ACS Nano

Article Title: Caveolar Endocytosis Governs Nanoneedle Transfection

doi: 10.1021/acsnano.5c11011

Figure Lengend Snippet: Caveolin 1 knock in induces nanoneedle transfection in Tregs. (a) Cell viability after nucleofection of CAV-1-mCherry into Tregs (Treg-KI) compared to untreated control. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bar. (b) Representative flow cytometry histogram for groups presented in (a). (c) Fraction of Treg-KI expressing mCherry compared to the untreated control. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, p -value is indicated above the bars. (d) Representative flow cytometry histogram for groups presented in (c). (e) Uptake of caveolae-specific cargo cholera toxin B (CTxB) in nN RCF Treg-KI compared to the nN RCF Treg control (nN RCF Treg −ve). Data presented as mean ± SD, n = 3 independent samples, ordinary one-way ANOVA, followed by Tukey’s multiple comparisons test, p -values are indicated above the bars. (f) Representative flow cytometry histogram for groups presented in (e). (g) Nanoneedle transfection efficiency for purified Treg-KI (nN RCF Treg +ve) and nN RCF Treg −ve. Data presented as mean ± SD, n = 3 independent samples, unpaired t test, and p -values are indicated above the bars. (h) Representative flow cytometry histogram for groups presented in (g).

Article Snippet: The CAV-1 sgRNA target sequence (AUGUUGCCCUGUUCCCGGAU) was ordered from Synthego.

Techniques: Knock-In, Transfection, Control, Flow Cytometry, Expressing, Purification

Journal: eClinicalMedicine

Article Title: Solvent-based or nab-paclitaxel plus ramucirumab for pretreated gastric cancer with peritoneal dissemination and prespecified biomarker analysis (P-SELECT/WJOG10617G): a randomised phase 2 trial in Japan

doi: 10.1016/j.eclinm.2026.103768

Figure Lengend Snippet: Stromal Caveolin-1 (Cav-1) expression and survival outcome in gastric cancer. (A–D) Representative immunohistochemistry (IHC) images of stromal Cav-1 expression. (A) IHC Score 0: negative staining. (B) IHC Score 1+: weak to moderate staining, less intense than vascular endothelium. (C) IHC Score 2+: staining intensity comparable to vascular endothelium. (D) IHC Score 3+: strong staining, more intense than vascular endothelium. (E–H) Kaplan–Meier survival curves stratified by stromal Cav-1 expression. (E) Overall survival (OS) in the solvent-based paclitaxel (sb-PTX) + ramucirumab (RAM) arm. (F) Progression-free survival (PFS) in the sb-PTX + RAM arm. (G) OS in the nab-paclitaxel (nab-PTX) + RAM arm. (H) PFS in the nab-PTX + RAM arm.

Article Snippet: Cav-1 expression was assessed by immunohistochemistry (IHC) using a specific anti-Cav-1 monoclonal antibody (D46G3, Cell Signaling Technology, Danvers, MA, USA; 1:800) and scored based on staining intensity in the tumour stroma as follows: 0 (negative), 1+ (weak), 2+ (comparable to vascular endothelium), and 3+ (stronger than endothelium).

Techniques: Expressing, Immunohistochemistry, Negative Staining, Staining, Solvent

Journal: eClinicalMedicine

Article Title: Solvent-based or nab-paclitaxel plus ramucirumab for pretreated gastric cancer with peritoneal dissemination and prespecified biomarker analysis (P-SELECT/WJOG10617G): a randomised phase 2 trial in Japan

doi: 10.1016/j.eclinm.2026.103768

Figure Lengend Snippet: Overall survival stratified by stromal Caveolin-1 (Cav-1) expression in both treatment arms. (A) Immunohistochemistry (IHC) score 0/1+, (B) IHC score 2+, (C) IHC score 3+.

Article Snippet: Cav-1 expression was assessed by immunohistochemistry (IHC) using a specific anti-Cav-1 monoclonal antibody (D46G3, Cell Signaling Technology, Danvers, MA, USA; 1:800) and scored based on staining intensity in the tumour stroma as follows: 0 (negative), 1+ (weak), 2+ (comparable to vascular endothelium), and 3+ (stronger than endothelium).

Techniques: Expressing, Immunohistochemistry